top of page
Staphylococcus haemolyticus GMB0851

Staphylococcus haemolyticus GMB0851

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species: Staphylococcus haemolyticus
Strain type: GMB0851
Staining Information: Gram Positive

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : GTGCATACAAACTCTCGTGGTGTGACGGGCGGTGTGTACAAGACCCGGGAACGTATTCACCGTAGCATGC TGATCTACGATTACTAGCGATTCCAGCTTCATGTAGTCGAGTTGCAGACTACAATCCGAACTGAGAACAA CTTTATGGGATTTGCTTGACCTCGCGGTTTCGCTGCCCTTTGTATTGTCCATTGTAGCACGTGTGTAGCC CAAATCATAAGGGGCATGATGATTTGACGTCATCCCCACCTTCCTCCGGTTTGTCACCGGCAGTCAACTT AAAGTGCCCAACTTAATGATGGCAACTAAGCTTAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATCT CACAACACAAGCTGACAACAACCATGCACCACCTGTCACTTTGTCCCCCGAAGGGGAAGGCTCTATCTCT AGAGTTGTCAAAGGATGTCAAGATTTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCAC CGCTTGTGCGGGTCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAATGCTT AATGCGTTAGCTGCAGCACTAAGGGGCGGAAACCCCCTAACACTTAGCACTCATCGTTTACGGCGTGGAC TACCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGCACATCAGCGTCAGTTACAGACCAGAAAGTC GCCTTCGCCACTGGTGTTCCTCCATATCTATGCGCATTTCACCGCTACACATGGAATTCCACTTTCCTCT TATGCACTCAAGTTTTCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTTCACATCAGACTTAA AAAACCGCCTACGCGCGCTTTACGCCCAATAATTCCGGATAACGCTTGCCACCTACGTATTACCGCGGCT GCTGGCACGTAGTTAGCCGTGGCTTTCTGATTAGGTACCGTCAAGACGTGCATAGTTACTTACACGTATG TTCTTCCCTAATAACAGAGTTTTACGATCCGAAGACCTTCATCACTCACGCGGCGTTGCTCCGTCAGGCT TTCGCCCATTGCGGAAGATTCCCTATTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT GGCCGATCACCCTCTCAGGTTGGCTACGTATGGTCGCCTTGGTAAGCCGTTACCTTACCAACTAGCTACT ACGGCGCGGGTCCATCTATAAGTGATAGCAAAACCATCTTTCACTATCGAACCATGCGGTTCGAAATATT ATCCGGTATTAGCTCCGGTTTCCCGAAGTTATCCCAGTCTTATAGGTAGGTTACCCACGTGCTACTCACC CGTCCGC

bottom of page