top of page
Bacteroides thetaiotaomicron  GMB0903

Bacteroides thetaiotaomicron GMB0903

$400.00Price

Product category: Bacteria

Product type: Anaerobe
Species : Bacteroides thetaiotaomicron
Strain type : GMB0903
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : CGCTCGTTGTGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCAC CTTCACATTTGCCTTGCGGCTAACCTGTTTCCAGATTATTCAAATGCAATTTAAGCCCGGGTAAGGTTCC TCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCA CCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAATGCTTTCGCTTGGCCGCTTACTGTATATCGCAAAC AGCGAGTATTCATCGTTTACTGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAG CATCAGTGTCAGTTGCAGTCCAGTGAGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCA CCGCTACACCACGAATTCCGCCCACCTCTACTGTACTCAAGACAGCCAGTATCAACTGCAATTTTACGGT TGAGCCGCAAACTTTCACAACTGACTTAACTGTCCACCTACGCTCCCTTTAAACCCAATAAATCCGGATA ACGCTCGGATCCTCCGTATTACCGCGGCGGG

bottom of page