top of page
Klebsiella pneumoniae GMB1342

Klebsiella pneumoniae GMB1342

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe

Species: Klebsiella pneumoniae

Strain Type: GMB1342

Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16s rRNA gene sequence: GGTAGCGCCCTCCCGAAGGTTAAGCTACCTACTTCTTTTGCAACCCACTCCCATGGTGTGACGGGCGGTG TGTACAAGGCCCGGGAACGTATTCACCGTAGCATTCTGATCTACGATTACTAGCGATTCCGACTTCATGG AGTCGAGTTGCAGACTCCAATCCGGACTACGACATACTTTATGAGGTCCGCTTGCTCTCGCGAGGTCGCT TCTCTTTGTATATGCCATTGTAGCACGTGTGTAGCCCTGGTCGTAAGGGCCATGATGACTTGACGTCATC CCCACCTTCCTCCAGTTTATCACTGGCAGTCTCCTTTGAGTTCCCGGCCGAACCGCTGGCAACAAAGGAT AAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAGCACC TGTCTCACAGTTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCTGTGGATGTCAAGACCAGGTAAGGTT CTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTT TAACCTTGCGGCCGTACTCCCCAGGCGGTCGATTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCA CAACCTCCAAATCGACATCGTTTACAGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTT TCGCACCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCA TTTCACCGCTACACCTGGAATTCTACCCCCCTCTACAAGACTCTAGCCTGCCAGTTTCGAATGCAGTTCC CAGGTTGAGCCCGGGGATTTCACATCCGACTTGACAGACCGCCTGCGTGCGCTTTACGCCCAGTAATTCC GATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGT AACGTCAATCGACAAGGTTATTAACCTCATCGCCTTCCTCCCCGCTGAAAGTGCTTTACAACCCGAAGGC CTTCTTCACACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCC CGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCG CCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCTGATGGCATGAGGCCCGAAG GTCCCCCACTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCATCA GGCAGTTTCCCAGACATTACTCACCCGTCCGCCGCTCGTCACCCGAGAGCAAGCTCTCTGTGCTACCGCT CGACTGCATGTGTTAGC

bottom of page