top of page
Pseudomonas stutzeri GMB1405

Pseudomonas stutzeri GMB1405

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe

Species: Pseudomonas stutzeri

Strain Type: GMB1405

Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --
16s rRNA gene sequence: CTAGTGGTACTGTGCCTCCCGAAGGTTAGACTAGCTACTTCTGGAGCAACCCACTCCCATGGTGTGACGG GCGGTGTGTACAAGGCCCGGGAACGTATTCACCGTGACATTCTGATTCACGATTACTAGCGATTCCGACT TCACGCAGTCGAGTTGCAGACTGCGATCCGAGATCTACGGATTTCGGTTTTATGGGATTAGCTCCCACCT CGCGGCTTGGCAACCCTTTGTACCGACCATTGTTAGGCACGTGGTGTAGCCCAGGCCGGTAAGGGCCATG ATGACTTGAACGTCATCCCCACCTTCCTCCGGTTTGTCACCGGCAGTCTCCTTAGAAGTGGCCCACCTTA ACGTGCTGGTAACTAAGGACAAGGGTTGCGCTCGTTACGGGACTTAACCCAACATCTCACGACACGAGCT GACGACAGCCATGCAGCACCTGTGTCAGAGTTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCTCTGCA TGTCAAGGCCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCC CCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAATGCGTTAGCTGCG CCACTAAGATCTCAAGGATCCCAACGGCTAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAAT CCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATTAGCCCAGGTGGTCGCCTTCGCCACTGGTG TTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACCCTCTGCCATACTCTAGCTCG CCAGTTTTGGATGCAGTTCCCAGGTTGAGCCCGGGGCTTTCACATCCAACTTAACGAACCACCTACGCGC GCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAG CCGGTGCTTATTCTGTTGGTAACGTCAAAACAGCAAGGTATTAACTTACTGCCCTTTCCTCCCAACTTAA AGTGCTTTACAATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCAGGCTTTCGCCCATTGTCCA ATATTCCCCACTGCTGGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGACTGATCATCCTC TCGAGACCAGTTACGGAATCGTCGCCTTGGTGAGCCTTTACCTCACCAACTTAGCTAATCTCGAACCTAG GCTCATCTGATAGCGTGAGGTCCGAAGATCCCCCACTTTCTCCCGTAGGACGTATGCGGTATTAGCGTTC CTTTCGAAACGTTGTCCCCCACTACCAGGCAGATTCCTAGGCATTACTCACCCGTCCGCCGCTGAATCAT GGAGCAAGCTCCACTCATCCGCTCGACATGCA

bottom of page