top of page
Vibrio atypicus  GMB1429

Vibrio atypicus GMB1429

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species: Vibrio atypicus
Strain : GMB1429
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : GGTGAGCGTCCCCCCGAAGGTTAAACTACCTACTTCTTTTGCAGCCCACTCCCATGGTGTGACGGGCGGT GTGTACAAGGCCCGGGAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCGACTTCATG GAGTCGAGTTGCAGACTCCAATCCGGACTACGACGCACTTTTTGGGATTCGCTCACTTTCGCCAAGTTAG GCCGCCCTCTCGTATGCGCCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGACTGACTTGACG TCGTCCCCACCTTCCTCCGGTTTATCACCGGCAGTCTCCCTGGAGTTCCCGACATTACTCGCTGGCAAAC AAGGATAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGC AGCACCTGTCTCAGAGTTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCTCTGGATGTCAAGAGTAGGT AAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTT GAGTTTTAATCTTGCGACCGTACTCCCCAGGCGGTCTACTTAACGCGTTAGCTCCGAAAGCCACGGCTCA AGGCCACAACCTCCAAGTAGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCC ACGCTTTCGCATCTGAGTGTCAGTATCTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTTCAGATCTC TACGCATTTCACCGCTACACCTGAAATTCTACCCCCCTCTACAGTACTCTAGTCTGCCAGTTTCAAATGC TATTCCGAGGTTGAGCCCCGGGCTTTCACATCTGACTTAACAAACCACCTGCATGCGCTTTACGCCCAGT AATTCCGATTAACGCTCGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCT GTCGCTAACGTCAAATCTATAACGCTATTAACGCATAAATCCTTCCTCACGACTGAAAGTGCTTTACAAC TCCGAAGGCCTTCTTCACACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACT GCCTGCCTCCCGTAGGAGTCTGGGACCGTGTCTCAGTTCCAGTGTGGCTGATCATCCTCTCAGACCAGCT AGGGATCGTCGCCTTGGTGAGCCCTTACCTCACCAACTAGCTAATCCCACCTAGGCATATCCTGACGCGA GAGGCCCGAAGGTCCCCCTCTTTGGCCCGTAGGCATCATGCGGTATTAGCCATCGTTTCCAATGGTTATC CCCCACATCAGGGCAATTTCCTAGGCATTACTCACCCGTCCGCCGCTCGACGCCGTTAACGTCCCCCGAA GGTTCAGTTAACTCGTTACCGCTCGACTGCA

bottom of page