top of page
Klebsiella sp. GMB1997

Klebsiella sp. GMB1997

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe

Species: Klebsiella sp. Strain Type: GMB1997

Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --
16s rRNA gene sequence : GGTCGCGGCGGTGCGACTGGGAGCTACGTACTAATTTTGCAGGCCACTCCCATGGTGTGACGGGCGGTGT GTACAAGGCCCGGGAACGTATTCACCGTAGCATTCTGATCTACGATTACTAGCGATTCCGACTTCATGGA GTCGAGTTGCAGACTCCAATCCGGACTACGACATACTTTATGAGGTCCGCTTGCTCTCGCGAGGTCGCTT CTCTTTGTATATGCCATTGTAGCACGTGTGTAGCCCTGGTCGTAAGGGCCATGATGACTTGACGTCATCC CCACCTTCCTCCAGTTTATCACTGGCAGTCTCCTTTGAGTTCCCGGCCTAACCGCTGGCAACAAAGGATA AGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAGCACCT GTCTCACAGTTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCTGTGGATGTCAAGACCAGGTAAGGTTC TTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTT AACCTTGCGGCCGTACTCCCCAGGCGGTCGATTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCAC AACCTCCAAATCGACATCGTTTACAGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTT CGCACCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCAT TTCACCGCTACACCTGGAATTCTACCCCCCTCTACAAGACTCTAGCCTGCCAGTTTCGAATGCAGTTCCC AGGTTGAGCCCGGGGATTTCACATCCGACTTGACAGACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCG ATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTA ACGTCAATCGACAAGGTTATTAACCTCATCGCCTTCCTCCCCGCTGAAAGTGCTTTACAACCCGAAGGCC TTCTTCACACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCC GTAGGAGTCTGGACCGTGTTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCG CCTAGGTGAGCCGTTACCCCACCTACCAGCTAATCCCATCTGGGCACATCTGATGGCATGAGGCCCGAAG GTCCCCCACTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCATCA GGCAGTTTCCCAGACATTACTCACCCGTCCGCCGCTCGTCACCCGAGAGCAAGCTCTCGGAGCTACCGAT CGA

bottom of page