top of page
Bacteroides sp. GMB2244

Bacteroides sp. GMB2244

$400.00Price

Product category: Bacteria

Product type: Anaerobe
Species: Bacteroides sp.
Strain type: GMB2244
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to neomycin and chloramphenicol.

16 rRNA gene sequence : TGCGGTTACGCACTTCAGGTACCCCCGGCTTTCATGGCTTGACGGGCGGTGTGTACAAGGCCCGGGAAC GTATTCACCGCGCCGTGGCTGATGCGCGATTACTAGCGAATCCAGCTTCATGGAGTCGGGTTGCAGACTC CAATCCGAACTGAGAGAGGCTTTAGGGATTAGCATCACGTCGCCGTGTAGCTGCCTTCTGTACCCCCCAT TGTAACACGTGTGTAGCCCCGGACGTAAGGGCCGTGCTGATTTGACGTCATCCCCACCTTCCTCACATCT TACGACGGCAGTCTCGACAGAGTCCCCAGCATAACCTGATGGTAACTATCGATAAGGGTTGCGCTCGTTA TGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTCACAACTGCCTTGCG GCTGACATGTCTCCACATCATTCAGTTGCAATTCAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTA AACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCC CCAGGTGGAATACTTAACGCTTTCGCTTGGCCGCTTACTGTATATCGCAAACAGCGAGTATTCATC GTTTACTGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCATCAGCGTCA GTTACAGTCCAGCAAGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACC ACGAATTCCGCCTGCCTCTACTGTACTCAAGACACCCAGTATCAACTGCAATTTTACGGTTGAGCCGCAA ACTTTCACAACTGACTTAAGCGTCCGCCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGAT CCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGATCCTTATTCATACGGTACATACAAAAAGGCA CGCGTGCCTCACTTTATTTCCCGTATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTTCACGCTAC TTGGCTGGTTCAGACTCTCGTCCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGAGTTTGGACCGT GTCTTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGGCTTGGTGGGCCGTTAC CCCGCCAACAACCTAATGGAACGCATCCCCATCGATGACCGAAATTCTTTAATAGTTCTACCATGCGGA AGAACTATGCCATCGGGTATTAATCTTTCTTTCGAAAGGCTATCCCCGAGTCATCGGCAGGTTGGATACG TGTTACTCACCCGTGCGCCGGTCGCCATCAAACTTAGCAAGCTAAGTTCATGCTGCCCCTCGACTTG CATGTGCT

bottom of page