top of page
Parabacteroides sp. GMB2245

Parabacteroides sp. GMB2245

$400.00Price

Product category: Bacteria

Product type: Anaerobe
Species : Parabacteroides sp.
Strain type: GMB2245
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to ampicillin and Kanamycin.

16 rRNA gene sequence : CACATATCATCTCGAGTGTGAGCAGCGCACGGTAGCAGTACACCGCCGGCGACCGGCGCACGGGTGAGTAA CGCGTATGCAACTTGCCTATCAGAGGGGGATAACCCGGCGAAAGTCGGACTAATACCGCATGAAGCAGGG ATCCCGCATGGGAATATTTGCTAAAGATTCATCGCTGATAGATAGGCATGCGTTCCATTAGGCAGTTGGC GGGGTAACGGCCCACCAAACCGACGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACCATTGGTACTGA GACACGGACCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCCAATGGGCGTAAGCCTGAACCAG CCAAGTCGCGTGAGGGATGAAGGTTCTATGGATCGTAAACCTCTTTTATAAGGGAATAAAGTGCGGG ACGTGTCCCGTTTTGTATGTACCTTATGAATAAGGATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATAC GGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTG AAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAA TGCGTGGTGTAGCGGTGAAATGCATAGATATCACGCAGAACCCCGATTGCGAAAGGCAGCCTGCCAAGCC ATGACTGACAGCTGATGCAACGAAAGCGTGGGGATCAGAACAGGATTAGATACCCTGGTAGTCCACGCAG TAAACGATGATCACTAGCTGTTTGCGATACACTGTAAGCGGCACAGCGAAAGCGTTAAGTGATCCACCTG GGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGT TTAATTCGATGATACGCGAGGAACCTTACCCGGGTTTGAACGCATTCGGACCGAGGTGGAAACACCTTTT CTAGCAATAGCCGTTTGCGAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGCTTAAGTG CCATAACGAGCGCAACCCTTGCCACTAGTTACTAACAGGTTAGGCTGAGGACTCTGGTGGGACTGCCAGC GTAAGCTGCGAGGAAGGCGGGGATGACGTCAAATCAGCACGGCCCTTACATCCGGGGCGACACACGTGTT ACAATGGCGTGGACAAAGGGAGGCCACCTGGCGACAGGGAGCGAATCCCCAAACCACGTCTCAGTTCGGA TCGGAGTCTGCAACCCGACTCCGTGAAGCTGGATTCGCTAGTAATCGCGCATCAGCCATGGCGCGGTGAA TACGTTCCCGGGCCTTGTACACACCGCCCGTCAAGCCATGGGAGCCGGGGGTACCTGAAGTCCGTAACAC

bottom of page