top of page
Parabacteroides sp. GMB2246

Parabacteroides sp. GMB2246

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species : Parabacteroides sp.
Strain type: GMB2246
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to erythromycin and doxycycline.

16 rRNA gene sequence : CAGATCGATCTCGAGGGGCAGCATGATTTGTAGCAATACAGATTGATGGCGACCGGCGCACGGGTG AGTAACGCGTATGCAACTTACCTATCAGAGGGGGATAGCCCGGCGAAAGTCGGATTAATACCCCATAAAA CAGGGGTCCCGCATGGGAATATTTGTTAAAGATTCATCGCTGATAGATAGGCATGCGTTCCATTAGGC AGTTGGCGGGGTAACGGCCCACCAAACCGACGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCA CATTGGTACTGAGACACGGACCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGC CGAGAGGCTGAACCAGCCAAGTCGCGTGAAGGAAGAAGGATCTATGGTTTGTAAACTTCTTTTATA GGGGAATAAAGTGGAGGACGTGTCCTTTTTTGTATGTACCCTATGAATAAGCATCGGCTAACTCCGTG CCAGCAGCCGCGGTAATACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGT GGTGATTTAAGTCAGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGGGTTACTT GAGTGTGTTTGAGGTAGGCGGAATGCGTGGTGTAGCGGTGAAATGCATAGATATGCACGCAGAA CTCCGATTGCGAAGGCAGCTTACTAAACCATAACTGACACTGAAGCACGAAAGCGTGGG GATCAAACAGGATTAGATACCCTGGTAGTCCACGCAGTAAACGATGATTACTAGGAGTTTGCGACTAC AATGTAAGCTCTACAGCGAAAGCGTTAAGTAATCCACCTGGGGAGTACGCCGGCAACGGTGA AACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGA ACCTTACCCGGGTTTGAACGTAGTCTGACCGGAGTGGAAACACTCTTTCTAGCAATAGCAGATTACGAGG TGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGCTTAAGTGCCATAACGAGCGCAACCCTTAT CACTAGTTACTAACAGGTGAAGCTGAGGACTCTGGTGAGACTGCCAGCGTAAGCTGTGAGGAAGGTGGGG ATGACGTCAAATCAGCACGGCCCTTACATCCGGGGCGACACACGTGTTACAATGGCATGGACAAAGGGCA GCTACCTGGTGACAGGATGCTAATCTCCAAACCATGTCTCAGTTCGGATCGGAGTCTGCAACTCGACTCC GTGAAGCTGGATTCGCTAGTAATCGCGCATCAGCCATGGCGCGGTGAATACGTTCCCGGGCCTTGTACAC ACCGCCCGTCAAGCCATGGGAGCCGGGGGTACCTGAAGTCCGTAACCGCAAGGA

bottom of page