top of page
Barnesiella sp. GMB2252

Barnesiella sp. GMB2252

$400.00Price

Product category: Bacteria

Product type: Anaerobe
Species: Barnesiella sp.
Strain tyype: GMB2252
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to erythromycin and doxycycline.

16 rRNA gene sequence : GTACGCTCCTTGCGGTTGCATGCTTCAGGTACTCCCGGCTTCCATGGCTTGACGGGCGGTGTGTACAA GGCCCGGGAACGTATTCACCGCGCCATGGCTGATGCGCGATTACTAGCGAATCCAGCTTCATGGAGTCGG GTTGCAGACTCCAATCCGAACTGAGACAGGTTTTCGGGATTCGCGCGTCATTGCTGACTGGCTGCCTTC TGTACCTGCCATTGTAACACGTGTGTCGCCCCGGACGTAAGGGCCGTGCTGATTTGACGTCATCCCCAC CTTCCTCGCGGCTTGCGCCGGCAGTCTCGACAGAGTCCTCGGCTTCACCCGTTAGTAACTGTCGATAGGG GTTGCGCTCGTTATGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCCATGCAGCACCT CGCAGGTGACTATTACTAGCTGCCGGCTTTCACCGACATTCCCCCTGCGTTTGAGCCCGGGTAAGGTTCC TCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCA CCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAACGCTTTCGCTGTACCGCTTACATTGTATCGCAAAC AGTTAGTATTCATCGTTTACTGCGTGGACTACCAGGGTATCTAATCCTGTTCGATACCCACGCTTTCGTG CCTCAGCGTCTGTTTCACCCTAGCAGGCTGCCTTCGCAATCGGGGTTCTGCGTGATATCTATGCATTTCA CCGCTACACCACGCATTCCGCCTGCCTCTTGTGTACTCTAGCTCGCCAGTTTCAACGGCACACTCCGGGT TGAGCCCGGAAATTTCACCGCTGACTTGGCGTGCCGCCTACGCACCCTTTAAACCCAATAAATCCGGATA ACGCTCGCATCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGATGCTTTTTCTTCGGATACTTG CAATACGCTACACGTAGCGTACTTTACTCTCCGACAAAAGAGGTTTACAACCCGTAAGGGCCGTCTTCCC TCACGCGACTTGGGCTGGTTTCAGTCTGCCGACCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGA GTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGTCGCTTT GGTGGGCCGTTACCCCGCCAACTGGCTAATGGAGCGCATGCTCGTCTGTAACCAAAATTGCTCTCTTTAA TGAACTCTCCATGCGGAGCGCCCATATTATGGGGTATTAGTCCGGATTTCTCCGGGTTATCCCCCTGTTA CAGGTGGATTGCATACGTGTTACTCACCCGTGCGCCGGTCGCCGGCAAAGGTATTGCTACCTCCCCGCT GCCCCTCGAGATCCATCTGCT

bottom of page