top of page
Candida sp. GMB2275

Candida sp. GMB2275

$400.00Price

Product category: Fungi

Product type: Anaerobe
Species: Candida sp.
Strain type: GMB2275
Staining Information: Gram Positive

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This fungus is resistant to amphotericin b and clotrimazole.
ITS gene sequence : TTTTTCCTCCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAAGTTTGAAGATATACGTGGTGGACGTTACCGCCGCAAACAATGTTTTTGGTTAGACCTAAGCCATTGTCAAAGCGATCCCGCCTTACCACTACCGTCTTTCAAGCAAACCCAAGTCGTATTGCTCAACACCAAACCCAGCGGTTTGAGGGAGAAACGACGCTCAAACAGGCATGCCCTCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAATATCTGCAATTCATATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGACTATTAGTAATAATCTGGTGTGACAAGTTGATAAAAAATTGGTTGTAAGTTTAGACCTCTGGCGGCAGGCTGGGCCCACCGCCAAAGCAAGTTTGTTTCAAAGAAAAACACATGTGGTGCAATTAAGCAAATCAGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTT ACTTCCCAAAA

bottom of page