top of page
Debaryomyces nepalensis GMB2313

Debaryomyces nepalensis GMB2313

$400.00Price

Product category: Fungi

Product type: Anaerobe
Species name : Debaryomyces nepalensis
Strain Type: GMB2313
Staining Information: Gram Positive

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried

Storage Condition: 4~ -70 ℃

Characteristics: This fungi is resistant to amphotericin and clotrimazole.
ITS gene sequence : TTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAACTTGTTTGTTATATTGTAAGGCCGAGCCTAGAATACCGAGAAATATACCATTAAACTATTCAACGAGTTGGATAAACCTAATACATTGAAAGTCATATAGCACTATCCAGTACCACTCATGCCAATACATTTCAAGCAAACGCCTAGTTCGACTAAGAGTATCACTCAATACCAAACCCGAAGGTTTGAGAGAGAAATGACGCTCAAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCATATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGATTTTTTGAATTTAATCAACAAATTGACAATTAAAATAAATAACAATTCAATATAAATATTGAAGTTTAGTTTAGTAAACCTCTGGCCCAAACTATTTCTAGTCCAGACCAAAGCAAGAGTTCTTGTAATAACAAAAAACACTGTGTGTAAGGTTTTTTCGCCGCGCAATTAAGCGCTGGCAAAAAGAATACTGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCC

bottom of page