top of page
Parabacteroides distasonis GMB2314

Parabacteroides distasonis GMB2314

$400.00Price

Product category: Bacteria

Product type: Anaerobe
Species: Parabacteroides distasonis
Strain type: GMB2314
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to ampicillin and gentamicin.

16 rRNA gene sequence
: GGTCCGATCCTTTCGGTTACGGACTTCAGGTACCCCCGGCTCCCATGGCTTGACGGGCGGTGTGTACAAG GCCCGGGAACGTATTCACCGCGCCATGGCTGATGCGCGATTACTAGCGAATCCAGCTTCACGGAGTCGGG TTGCAGACTCCGATCCGAACTGAGACGTGGTTTGGGGATTCGCTCCCTGTCGCCAGGTGGCTTCCCTTTG TCCACGCCATTGTAACACGTGTGTCGCCCCGGATGTAAGGGCCGTGCTGATTTGACGTCATCCCCGCCTT CCTCGCAGCTTACGCTGGCAGTCCCACCAGAGTCCTCAGCTTTACCTGTTAGTAACTAGTGGCAAGGGTT GCGCTCGTTATGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTCGCAAA CGGCTATTGCTAGAAAAGGTGTTTCCACCTCGGTCCGAATGCGTTCAAACCCGGGTAAGGTTCCTCGCGT ATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTG CCGGCGTACTCCCCAGGTGGATCACTTAACGCTTTCGCTGTGCCGCTTACACTGTATCGCAAACAGCTAG TGATCATCGTTTACTGCGTGGACTACCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGTGCATCA GCGTCAGTCATGGCTTGGCAGGCTGCCTTCGCAATCGGGGTTCTGCGTGATATCTAAGCATTTCACCGCT ACACCACGCATTCCGCCTGCCTCAAACATACTCAAGCCCCCCAGTTTCAACGGCAATTCTATGGTTGAGC CACAGACTTTCACCGCTGACTTAAAAGGCCGCCTACGCACCCTTTAAACCCAATAAATCCGGATAACGCT CGGATCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGATCCTTATTCATAAGGTACATACAAAA CAGGACACGTCCCGCACTTTATTCCCTTATAAAAGAGGTTTACGATCCATAGAACCTTCATCCCTCAC GCGACTTGGCTGGTTCAGGCTTACGCCCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGAGTTTGG TCCGTGTCTCAGTACCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGTCGGTTTGGTGGGCC GTTACCCCGCCAACTGCCTAATGGAACGCATGCCTATCTATCAGCGATGAATCTTTAGCAAATAT CCCCATGCGGGGCCCCTGCTTCATGCGGTATTAGTCCGACTTTCGCCGGGTTATCCCCCTCTGATAG GTAAGTTGCATACGCGTTACTCACCCGTGCGCCGGTCGCCACCCGGTATTGCTACCTGTGCTGCCCCTCG A

bottom of page