top of page
Candida sp. GMB2317

Candida sp. GMB2317

$400.00Price

Product category: Fungi

Product type: Facultative anaerobe
Species: Candida sp.
Strain type: GMB2317
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This fungus is resistant to amphotericin b and clotrimazole.
ITS gene sequence : TTTCCTCCGGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAAGTTTGAAG ATATACGTGGTAGACGTTACCGCCGCAAGCAATGTTTTTGGTTAGACCTAAGCCATTGTCAAAGCGATCC CGCCTTACCACTACCGTCTTTCAAGCAAACCCAAGTCGTATTGCTCAACACCAAACCCAGCGGTTTGAGG GAGAAACGACGCTCAAACAGGCATGCCCTCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGAT GATTCACGAATATCTGCAATTCATATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAA GAGATCCGTTGTTGAAAGTTTTGACTATTAGTAATAATCTGGTGTGACAAGTTGATAAAAAATTGGTTGT AAGTTTAGACCTCTGGCGGCAGGCTGGGCCCACCGCCAAAGCAAGTTTGTTTCAAAGAAAAACACATGTG GTGCAATTAAGCAAATCAGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTAC TTCCCAGA

bottom of page