top of page
Klebsiella sp. GMB2361

Klebsiella sp. GMB2361

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species: Klebsiella sp.
Strain type: GMB2361
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to erythromycin and doxycycline

16 rRNA gene sequence : GGTGAGCGCCCTCCCGAAGGTTAAGCTACCTACTTCTTTTGCAACCCACTCCCATGGTGTGACGGGCGGT GTGTACAAGGCCCGGGAACGTATTCACCGTAGCATTCTGATCTACGATTACTAGCGATTCCGACTTCATG GAGTCGAGTTGCAAGACTCCAATCCGGACTACGACATACTTTATGAGGTCCGCTTGCTCTCCGCGAGGTC GCTTCTCTTTGTATATGCCATTGTAGCACGTGTGGTAGCCCTGGTCGTAAGGGCCATGATGACTTGACGT CATCCCCACCTTCCTCCAGTTTATCACTGGCAGTCTCCTTTGGAGTTCCCGGCCGGACCGCTGGCAACAA AGGATAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCA GCACCTGTCTCACAGTTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCTGTGGATGTCAAGACCAGGTA AGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTG AGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGATTTAACGCGTTAGCTCCGGAAGCCACGCCTCAA GGGCACAACCTCCAAATCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCA CGCTTTCGCACCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCT ACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACAAGACTCTAGCCTGCCAGTTTCGAATGCA GTTCCCAGGTTGAGCCCGGGGATTTCACATCCGACTTGACAGACCGCCTGCGTGCGCTTTACGCCCAGTA ATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTG CGGGTAACGTCAATCGACTAAGGTTATTAACCTTAACGCCTTCCTCCCCGCTGAAAGTGCTTTACAACCC GAAGGCCTTCTTCACACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCT GCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGA TCGTCGCCTAGGTGAGCCGATTACCCCACCTACTAGCTAATCCCATCTGGGCACATCTGATGGCATGAGG CCCGAAGGTCCCCCACTTTGGTCTTGCGACATTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCC TCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCGCTCGTCACCCGAGAGCAAGCTCTCTGTGC TACCGCTCGACTGCA

bottom of page