top of page
Capnocytophaga ochracea  GMB0479

Capnocytophaga ochracea GMB0479

$400.00Price

Product category: Bacteria

Product type: Anaerobe
Species : Capnocytophaga ochracea
Strain type: GMB0479
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : CTTTCGGGTAACTGAGACCGGCGTACGGGTGCGTAACGCGTATACAATCTGCCTTTCACTGGGGGATAGCCCGAAGAAATTTGGATTAATACCCCATAGTATAGTAGTGTGGCATCACACAACTATTAAAGCTTAGGTGGTGAAAGATGAGTATGCGTTCTATTAGCTAGTTGGAGAGGTAACGGCTCCCCAAGGCGATGATAGATAGGGGTTCTGAGAGGGATGTCCCCCACACTGGTACTGAGATACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGAATATTGGACAATGGTCGGAAGACTGATCCAGCCATGCCGCGTGCAGGATGACGGCCTTATGGGTTGTAAACTGCTTTTGTAAGGGAAGAATAAGGACTACGTGTAGTTTGATGACGGTACCTTATGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATGCGAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCTGTAGGCGGGCTGGTAAGTCAGAGGTGAAAGCGCTCAGCTCAACTGAGCAACTGCCTTTGAAACTGTTGGTCTTGAATGGTTGTGAAGTAGTTGGAATGTGTGGTGTAGCGGTGAAATGCTTAGATATTACACAGAACACCGATAGCGAAGGCATATTACTAACAATTAATTGACGCTGATGGACGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGGATACTAGCTGTTTGGAGTAATCTGAGTGGCTAAGCGAAAGTGATAAGTATCCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCAAGGTTTA

bottom of page