top of page
Edwardsiella sp. GMB1682

Edwardsiella sp. GMB1682

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species: Edwardsiella sp.
Strain type: GMB1682
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : GTGGTAAGCGCCCTCCCGAAGGTTAAGCTACCTACTTCTTTTGCAACCCACTCCCATGGTGTGACGGGCG GTGTGTACAAGGCCCGGGAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCGACTTCA TGGAGTCGAGTTGCAGACTCCAATCCGGACTACGACGTACTTTATGAGGTCCGCTTGCTCTCGCGAGGTC GCTTCTCTTTGTATACGCCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGATGACTTGACGTC ATCCCCACCTTCCTCCAGTTTATCACTGGCAGTCTCCTTTGAGTTCCCGGCCGAACCGCTGGCAACAAAG GATAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAGC ACCTGTCTCAGCGTTCCCGAAGGCACTCCCGTATCATCTACAGGATTCGCTGGATGTCAAGAGTAGGTAA GGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGA GTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGATTTAACGCGTTAGCTTCGGAAGCCACGCCTCAAG GGCACAACCTCCAAATCGACATCGTTTACAGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCAC GCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGAGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTA CGCATTTCACCGCTACACCTGGAATTCTACCTCCCTCTACGAGACTCTAGCTTGCCAGTCTTGGATGCAG TTCCCAGGTTAAGCCCGGGGATTTCACATCCAACTTAAACAAACCGCCTGCGTGCGCTTTACGCCCAGTA ATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTG TAGGTAACGTCAATTGTACGTGCTATTAACACGCACACCTTCCTCCCTACTGAAAGTACTTTACAACCCG AAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTG CCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGAT CGTCGCCTAGGTGAGCCATTACCTCACCTACTAGGCTAATCCCATCTGGGTTCATCTGATGGCATGAGGC CCGAAGGTCCCCCACTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCT CCATCAGGCAGATCCCCAGACATTACTCACCCGTCCGCCGCTCGTCAGCGAAGAAAGCAAGCTTTCTCCC TGCTACCGCTCGACTGCA

bottom of page