top of page
Edwardsiella tarda  GMB1681

Edwardsiella tarda GMB1681

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species : Edwardsiella tarda
Strain type: GMB1681
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : AACACATGCAAGTCGAGCGGTAGCAGGGAGAAAGCTTGCTTTCTTCGCTGACGAGCGGCGGACGGGTGAGTAATGTCTGGGGATCTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGACCTTCGGGCCTCATGCCATCAGATGAACCCAGATGGGATTAGCTAGTAGGTGAGGTAATGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGTAGGGAGGAAGGTGTGCGTGTTAATAGCACGTACAATTGACGTTACCTACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATCCAAGACTGGCAAGCTAGAGTCTCGTAGAGGGAGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCTCCTGGACGAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGTCGATTTGGAGGTTGTGCCCTTGAGGCGTGGCTTCCGAAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGT

bottom of page