top of page
Debaryomyces sp. GMB2323

Debaryomyces sp. GMB2323

$400.00Price

Product category: Fungi

Product type: Anaerobe
Species name : Debaryomyces dp.
Strain : GMB2323
Staining Information: Gram Positive

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried

Storage Condition: 4~ -70 ℃

Characteristics: This fungi is resistant to amphotericin and clotrimazole.
ITS gene sequence : TTCCTTCCGGCCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAACTTGTTTGTTATATTGTAAGGCCGAGCCTAGAATACCGAGAAATATACCATTAAACTATTCAACGAGTTGGATAAACCTAATACATTGAAAGTCATATAGCACTATCCAGTACCACTCATGCCAATACATTTCAAGCAAACGCCTAGTTCGACTAAGAGTATCACTCAATACCAAACCCGAAGGTTTGAGAGAGAAATGACGCTCAAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCATATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGATTTTTTGAATTTAATCAACAAATTGACAATTAAAATAAATAACAATTCAATATAAATATTGAAGTTTAGTTTAGTAAACCTCTGGCCCAAACTATTTCTAGTCCAGACCAAAGCAAGAGTTCTTGTAATAACAAAAAACACTGTGTGTAAGGTTTTTTCGCCGCGCAATTAAGCGCTGGCAAAAAGAATACTGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGATTTTTACTTCCAAAA

bottom of page