top of page
Citrobacter freundii  GMB0965

Citrobacter freundii GMB0965

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species : Citrobacter freundii
Strain type: GMB0965
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : GAAGGTTAAGCTACCTACTTCTTTTGCAACCCACTCCCATGGTGTGACGGGCGGTGTGTACAAGGCCCGG GAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCGACTTCATGGAGTCGAGTTGCAGA CTCCAATCCGGACTACGACATACTTTATGAGGTCCGCTTGCTCTCGCGAGGTCGCTTCTCTTTGTATATG CCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGATGACTTGACGTCATCCCCACCTTCCTCCA GTTTATCACTGGCAGTCTCCTTTGAGTTCCCGGCCGGACCGCTGGCAACAAAGGATAAGGGTTGCGCTCG TTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAGCACCTGTCTCAGAGTTCC CGAAGGCACCAAAGCATCTCTGCTAAGTTCTCTGGATGTCAAGAGTAGGTAAGGTTCTTCGCGTTGCATC GAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCG TACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCG ACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGT CAGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACAC CTGGAATTCTACCCCCCTCTACAAGACTCTAGCCTGCCAGTTTCGGATGCAGTTCCCAGGTTGAGCCCGG GGATTTCACATCCGACTTGACAGACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCA CCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGAGTAACGTCAATCGTTG CGGTTATTAACCACAACGCCTTCCTCCTCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACG CGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGA CCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGT TACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCTCTTTGG TCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCATCGGGCAGTTTCCCAGA CATTACTCACCCGTCCGCCACTCGTCACCCAAGGAGCAAGCTCCTCTGTGCTACCG

bottom of page