top of page
Klebsiella aerogenes GMB2132

Klebsiella aerogenes GMB2132

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe

Species: Klebsiella aerogenes

Strain Type: GMB2132

Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --


Sequence : GGTAAGCGCCCTCCCGAAGGTTAAGCTACCTACTTCTTTTGCAACCCACTCCCATGGTGTGACGGGCGGTG TGTACAAGGCCCGGGAACGTATTCACCGTAGCATTCTGATCTACGATTACTAGCGATTCCGACTTCATGG AGTCGAGTTGCAGACTCCAATCCGGACTACGACCATACTTTATGAGGTCCGCTTGCTCTCGCGA GGTCGCTTCTCTTTGTATATGCCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGATGACTTG ACGTCATCCCCACCTTCCTCCAGTTTATCACTGGCAGTCTCCTTTGAGTTCCCGGCCGGACCGCTGGCAA CAAAGGATAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCAT GCAGCACCTGTCTCAGAGTTCCCGAAGGCACCAAAGCATCTCTGCTAAGTTCTCTGGATGTCAAGAGTAG GTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCAT TTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCT CAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCC CCACGCTTTCGCACCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATC TCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACAAGACTCTAGCCTGCCAGTTTCGAAT GCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCCGACTTGACAGACCGCCTGCGTGCGCTTTACGCCCA GTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTT CTGCGAGTAACGTCAATCACCAAGGTTATTAACCTTAATGCCTTCCTCCTCGCTGAAAGTACTTTACAAC CCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTG CTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGAACCAGC TAGGGATCGTCGCCTAGGTGAGCCATTACCCCACCTACTAGCTAATCCCATCTGGGCACATCT GATGGCATGAGGCCCGAAGGTCCCCCACTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAG TAGTTATCCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCGCTCGTCACCCGAGAGCA AGCTCTCTGTGTTACCGCTCGACTTGCA

bottom of page