top of page
Purpureocillium lilacinum GMB2366

Purpureocillium lilacinum GMB2366

$400.00Price

Product category: Fungi

Product type: Aerobic
Species: Purpureocillium lilacinum
Strain type : GMB2366
Staining Information: Gram positive

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics:This fungus is resistant to amphotericin b and clotrimazole.

ITS gene sequence : TTCCTCCTCTTATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACTCTAAGAAAG TTGGGCGTTTTACGGCGTGACCGCCTCCGCGCTCCGGTGCGAGGTGTGTGCTACTACGCAGGGGAGGCTG CGGCGGGGTCGCCACTGCATTTCGGGGGCGGCTGGTGTGCCGTCCCCCAACACCGAGGCCCCCGGGGGGG CTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAA GATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCC AGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTTGCTTGTGCAACTCAGAGAAGAAATT CCGCCCGCTGGGCGTAATGCAAGAGAGTTTGGGGTCCCTGCGGCGGGCGCCTGGGTCCGGCGCCGGCGCG GGGGCAGGCGGCCGGGGCGTTCCCGCCGAGGCAACTGAGGTAAGGTTCACAGTGGGTTTGGGAGTTGTAT AACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTATTACTTCC

bottom of page