top of page
Morganella morganii subsp. morganii  GMB2303

Morganella morganii subsp. morganii GMB2303

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species: Morganella morganii subsp. morganii
Strain type : GMB2303
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to erythromycin, ampicillin, penicillin and azithromycin.

16 rRNA gene sequence: TGGTAGCGCCCTCCCTAAGGTTAAGCTACCTACTTCTTTTGCAACCCACTCCCATGGTGTGACGGGCGG TGTGTACAAGGCCCGGGAACGTATTCACCGTAGCATTCTGATCTACGATTACTAGCGATTCCGACTTCAT GGAGTCGAGTTGCAGACTCCAATCCGGACTACGACGTACTTTATGAGTTCCGCTTGCCCTCGCGGGGTCG CTTCCCTTTGTATACGCCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGATGACTTGACG TCATCCCCACCTTCCTCCGGTTTATCACCGGCAGTCTCCTTTGAGTTCCCGCCATCACGCGCTGGCAACA AAGGATAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGC AGCACCTGTCTCAGAGTTCCCGAAGGCACCAAAGCATCTCTGCTAAGTTCTCTGGATGTCAAGAGTAGGT AAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTT GAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCA AGGGCACAACCTCCAAGTCGACATCGTTTACAGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCC ACGCTTTCGCACCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCACATCTC TACGCATTTCACCGCTACACATGGAATTCTACCCCCCTCTACAAGACTCTAGCTGACCAGTATCAGATGC AATTCCCGGGTTAAGCCCGGGGATTTCACATCTGACTCAATCAACCGCCTGCGTGCGCTTTACGCCCAGT AATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCT GTCGGTAACGTCAATTGCCAAGGTTATTAACCTTGACACCTTCCTCCCGACTGAAAGTACTTTACAACC CGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCAC TGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCTGATCATCCTCTCAGACCA GCTAGGGATCGTCGCCTAGGTAAGCCGTTACCTTACCTACAAGCTAATCCCATATGGGTTCATCTG ATGGCGCGAGGCCCGGAGGTCCCCCGCTTTGGTCCGTAGACATTATGCGGTATTAGCTACCGTTTCCAGT AGTTATCCCCCGCCATCAGGCAGATCCCCATACATTACTCACCCGTCCGCCGCTCGTCAGCGGAGAAGCA AGCTTCTCCCTGTTACCGCCCGACTGCA

bottom of page