top of page
Morganella morganii GMB2364

Morganella morganii GMB2364

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species : Morganella morganii
Strain type: GMB2364
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : TGGTAGCGCCCTCCCGGAGGTTAAGCTACCTACTTCTTTTGCAACCCACTCCCATGGTGTGACGGGCGGT GTGTACAAGGCCCGGGAACGTATTCACCGTAGCATTCTGATCTACGATTACTAGCGATTCCGACTTCATG GAGTCGAGTTGCAGACTCCAATCCGGACTACGACGTACTTTATGAGTTCCGCTTGCCCTCGCGGGGTCGC TTCCCTTTGTATACGCCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGATGACTTGACGTCAT CCCCACCTTCCTCCGGTTTATCACCGGCAGTCTCCTTTGAGTTCCCGCCATCACGCGCTGGCAACAAAGG ATAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAGCA CCTGTCTCAGAGTTCCCGAAGGCACCAAAGCATCTCTGCTAAGTTCTCTGGATGTCAAGAGTAGGTAAGG TTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGT TTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGG CACAACCTCCAAGTCGACATCGTTTACAGCGTGGACTACCAGGGTATCTAATCCTGTTTG CTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTAT TCCTCCACATCTCTACGCATTTCACCGCTACACATGGAATTCTACCCCCCTCTACAAGACTCTAG CTGACCAGTATCAGATGCAATTCCCGGGTTAAGCCCGGGGATTTCACATCTGACTCAATCAACCGCCT GCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGG AGTTAGCCGGTGCTTCTTCTGTCGGTAACGTCAATTGCCAAGGTTATTAACCTTGACACCTTCCT CCCGACTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGG CTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGG CCGTGTCTCAGTCCCAGTGTGGCTGATCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAG GTAAGCCGTTACCTCACCTACTAGCTAATCCCATATGGGTTCATCTGATGGCGCGAGGCCCGGAGGTCCC CCGCTTTGGTCCGAAGACATTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCGCCATCAGGCAG ATCCCCATACATTACTCACCCGTCCGCCGCTCGTCAGCGGAGAAGCAAGCTTCTCCCTGTTACCGCCCGA CTGCATGTGT

bottom of page