top of page
Providencia rettgeri  GMB2331

Providencia rettgeri GMB2331

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species: Providencia rettgeri
Strain type: GMB2331
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to erythromycin and doxycycline

16 rRNA gene sequence : GTGGTAAGCGCCCTCCCGAAGGTTAAGCTACCTACTTCTTTTGCAACCCACTCCCATGGTGTGACGGGCGG TGTGTACAAGGCCCGGGAACGTATTCACCGTAGCATTCTGATCTACGATTACTAGCGATTCCGACTTCAT GGAGTCGAGTTGCAGACTCCAATCCGGACTACGACGTACTTTATGAGTTCCGCTTGCTCTCGCGAGGTCG CTTCTCTTTGTATACGCCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGATGACTTGACGTC ATCCCCACCTTCCTCCGGTTTATCACCGGCAGTCTCCTTTGAGTTCCCGACCGAATCGCTGGCAACAAA GGATAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAG CACCTGTCTCAGAGTTCCCGAAGGCACCAAAGCATCTCTGCTAAGTTCTCTGGATGTCAAGAGTAGGTAA GGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGA GTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGATTTAACGCGTTAGCTCCGAAAGCCACTCCTCAAG GGAACAACCTTCAAATCGACATCGTTTACAGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCAC GCTTTCGCACCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCACATCTCTA CGCATTTCACCGCTACACATGGAATTCTACCCCCCTCTACAAGACTCTAGCTGACCAGTCTTAGATGCCA TTCCCAGGTTAAGCCCGGGGATTTCACATCTAACTTAATCAACCGCCTGCGTGCGCTTTACGCCCAGTAA TTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCCGGTGCTTCTTCTG TCGGTAACGTCAATCGTTGATGATATTAGCATCAACGCCTTCCTCCCGACTGAAAGTACTTTACAACCC TAGGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCT GCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCTGATCATCCTCTCAGACCAGCTAGGGA TCGTCGCCTAGGTGAGCCATTACCTCACCTACTAGCTAATCCCATATGGGTTCATCCGATA GCGCAAGGACCGAAGTTCCCCTGCTTTGCTCCTAAGAGATTATGCGGTATTAGCTACCGTTTCCAGTAGT TATCCCCCTCTATCGGGCAGATCCCCATACATTACTCACCCGTCCGCCGCTCGTCAGCGAGAAGCAAGCT TCCCCTGTTACCGCTCGACTTGCATGTGT

bottom of page