top of page
Parabacteroides distasonis GMB2243

Parabacteroides distasonis GMB2243

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species: Parabacteroides distasonis
Strain : GMB2243
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to neomycin and chloramphenicol.

16 rRNA gene sequence : ACATGCAAGTCGAGGGGCAGCGGGGTGTAGCAATACACCGCCGGCGACCGGCGCACGGGTGAGTAACGCGTA TGCAACTTGCCTATCAGAGGGGGATAACCCGGCGAAAGTCGGACTAATACCGCATGAAGCAGGGATCCCG CATGGGAATATTTGCTAAAGATTCATCGCTGATAGATAGGCATGCGTTCCATTAGGCAGTTGGCGGGG TAACGGCCCACCAAACCGACGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGTACTGAGACAC GGACCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGGCGTAAGCCTGAACCAGCCAAGT CGCGTGAGGGATGAAGGTTCTATGGATCGTAAACCTCTTTTATAAGGGAATAAAGTGCGGGACGTGTCC CGTTTTGTATGTACCATTATGAATAAGGATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGAT CCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCT GTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG TGTAGCGGTGAAATGCTTAGATATCACGCAGAACCCCGATTGCGAAGGCAGCCTGCCAAGCCATGACTGA CGCTGATGCACGAAAGCGTGGGGATCAAACAGGATTAGATACCCTGGTAGTCCACGCAGTAAACGATGAT CACTAGCTGTTTGCGATACACTGTAAGCGGCACAGCGAAAGCGTTAAGTGATCCACCTGGGGAGTACGCC GGCAACGGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGAT GATACGCGAGGAACCTTACCCGGGGTTTGAACGCATTCGGACCGAGGTGGAAACACCTTTTCTAGCAATA GCCGTTTGCGAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGCTTAAGTGCCATAAC GAGCGCAACCCTTGCCACTAGTTACTAACAGGTAGCTGAGGACTCTGGTGGGACTGCCAGCGTAAG CTGCGAGGAAGGCGGGGATGACGTCAAATCAGCACGGCCCTTACATCCGGGGCGACACACGTGTTACA ATGGCGTGGACAAAGGGAGGCCACCTGGCGACAGGGAGCGAATCCCCAAACCACGTCTCAGTTCGGATC GGAGTCTGCAACCCGACTCCGTGAAGCTGGATTCGCTAGTAATCGCGCATCAGCCATGGCGCGGTGAA TACGTTCCCGGGCCTTGTACACACCGCCCGTCAAGCCATGGGAGCCGGGGGTACCTGAAGTCCGTAACCG CAAGGATC

bottom of page