top of page
Parabacteroides distasonis GMB2301

Parabacteroides distasonis GMB2301

$400.00Price

Product category: Bacteria

Product type: Anaerobe
Species : Parabacteroides distasonis
Strain type: GMB2301
Staining Information: Gram Positive

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to ampicillin and gentamicin.
16s rRNA gene sequence : TCTACGAGGCCGATCCTCGCGGTTACGGACTTCAGGTACCCCCGGCTCCCATGGCTTGACGGGCGGTGTG TACAAGGCCCGGGAACGTATTCACCGCGCCATGGCTGATGCGCGATTACTAGCGAATCCAGCTTCACGGA GTCGGGTTGCAGACTCCGATCCGAACTGAGACGTGGTTTGGGGATTCGCTCCCTGTCGCCAGGTG GCTTCCCTTTGTCCACGCCATTGTAACACGTGTGTCGCCCCGGATGTAAGGGCCGTGCTGATTT GACGTCATCCCCGCCTTCCTCGCAGCTTACGCTGGCAGTCCCACCAGAGTCCTCAGCTTTACC TGTTAGTAACTAGTGGCAAGGGTTGCGCTCGTTATGGCACTTAAGCCGACACCTCACGGC ACGAGCTGACGACAACCATGCAGCACCTCGCAAACGGCTATTGCTAGAAAAGGTGTTTCCACC TCGGTCCGAATGCGTTCAAACCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCT CCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGATCAC TTAACGCTTTCGCTGTGCCGCTTACACTGTATCGCAAACAGCTAGTGATCATCGTTTACTGCGTGGACTA CCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGTGCATCAGCGTCAGTCATGGCTTGGCAGGCTGC CTTCGCAATCGGGGTTCTGCGTGATATCTAAGCATTTCACCGCTACACCACGCATTCCGCCTGCCTCAAA CATACTCAAGCCCCCCAGTTTCAACGGCAATTCTATGGTTGAGCCACAGACTTTCACCGCTGACTTAAAA GGCCGCCTACGCACCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGCTGC TGGCACGGAGTTAGCCGATCCTTATTCATAAGGTACATACAAAACGGGACACGTCCCGAACTTTATTCCC TTATAAAAGAGGTTTACGATCCATAGAACCTTCATCCCTCACGCGACTTGGCTGGTTCAGGCTTACGCC CATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGAGTTTGGTCCGTGTCTCAGTACCAATGTGGGG GACCTTCCTCTCAGAACCCCTATCCATCGTCGGTTTGGTGGGCCGTTACCCCGCCAACTGCCTAATGGA ACGCATGCCTATCTATCAGCGATGAATCTTTAGCAAATATCCCCATGCGGGGCCCCTGCTTCATGCGG TATTAGTCCGACTTTCGCCGGGTTATCCCCCTCTGATAGGCAAGTTGCATACGCGTTACTCACCCGTGCG CCGGTCGCCAGCGGGTATTGCTACCCGCGCTGCCCCTCGACTTGCATGTGTTAG

bottom of page