top of page
Staphylococcus warneri  GMB0861

Staphylococcus warneri GMB0861

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species : Staphylococcus warneri
Strain type: GMB0861
Staining Information: Gram Positive

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : TTAACCCAACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACTTTGTCCCCCGAAGGGG AAGACTCTATCTCTAGAGCGGTCAAAGGATGTCAAGATTTGGTAAGGTTCTTCGCGTTGCTTCGAATTAA ACCACATGCTCCACCGCTTGTGCGGGTCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCC CAGGCGGAGTGCTTAATGCGTTAGCTGCAGCACTAAGGGGCGGAAACCCCCTAACACTTAGCACTCATCG TTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGCACATCAGCGTCAGTTA CAGACCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCATATCTCTGCGCATTTCACCGCTACACATGGAA TTCCACTTTCCTCTTCTGCACTCAAGTTTTCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTT CACATCAGACTTAAAAAACCGCCTACGCGCGCTTTACGCCCAATAATTCCGGATAACGCTTGCCACCTAC GTATTACCGC

bottom of page