top of page
Saccharomycopsis sp. GMB2298

Saccharomycopsis sp. GMB2298

$400.00Price

Product Name : JBS28-00103
Species : Saccharomycopsis sp.
Strain type: GMB2298
Staining Information: Gram Positive

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This fungus is resistant to amphotericin b and clotrimazole.

ITS gene sequence : TTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCTTACCTGATTTGAGGTCAAAATTAATGACA AAGTTATAAGGCCTTGATACAAGAGTAACACCTTTGCAAAAGGGTATTTAATAAGTTGGTAAAACCTAAT ATTAAATCCTTAAGCAAATATTAATGCGATACTCAATCAATTGCCAAGTCATTTCAAAGGAGTTAGCAAA ACTAACACAACCTTCAATACTAAACCAAAAGGTTTAAGAGAGAAATGACGCTCAAACAGGCATACTCTAC AGAATACTATAGAGTGCAATATGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCACATTACTT ATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGCTGAAAGTTTTAAACTTTTA GTAAATTGTTATGACTAAGGTATAAAAAAGATACATTTCTCCATAAAGAAGAGATGAGTTTATAAGAGCA GAATTAGGTTTAGCAAGTCTTTTCATCCTCACCAAACCAAAATTCGCAAACAAAAACAGTGTGTATAAGA GTTTATTAGACCGCGCAATTAAGCGCAGGTCCAAAAACAAATAACATTAATGATCCTTCCGCAGGTTCAC CTACGGAAACCTTGTTACGACTTTTACTTCCTTAGAAGG

bottom of page