top of page
Salmonella enterica subsp. enterica serovar Enteritidis  GMB0446

Salmonella enterica subsp. enterica serovar Enteritidis GMB0446

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species: Salmonella enterica subsp. enterica serovar Enteritidis
Strain type: GMB0446
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: --

16 rRNA gene sequence : TATCGGATTACTGGGCGTAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTTGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTTGGAGGTTGTGCCCTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAGTAGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCCATGCAACGCGAAGAACCTTACCTGGTCTTGACATCCACAGAAGAATCCAGAGATGGATTTGTGCCTTCGGGAACTGTGAAACAGGTGCTGCATGGCTGTCCTCATCTCGTGTTGTGAACTGTTGGGTTTGTCCCGCAGCGAGCGGCAACCCTCCA

bottom of page