top of page
Shigella sp. GMB2220

Shigella sp. GMB2220

$400.00Price

Product category: Bacteria

Product type: Facultative anaerobe
Species : Shigella sp.
Strain type : GMB2220
Staining Information: Gram negative

Growth Medium: JM medium

Culture Condition: 37℃

Product Format: Freeze dried ampoule

Storage Condition: 4~ -70 ℃

Characteristics: This bacterium is resistant to erythromycin and doxycycline.

16 rRNA gene sequence : GGTAAGCGCCCTCCCGAAGGTTAAGCTACCTACTTCTTTTGCAACCCACTCCCATGGTGTGACGGGCGGT GTGTACAAGGCCCGGGAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCGACTTCATG GAGTCGAGTTGCAGACTCCAATCCGGACTACGACGCACTTTATGAGGTCCGCTTGCTCTCGCGAGGTCGC TTCTCTTTGTATGCGCCATTGTAGCACGTGTGTAGCCCTGGTCGTAAGGGCCATGATGACTTGACGTCAT CCCCACCTTCCTCCAGTTTATCACTGGCAGTCTCCTTTGAGTTCCCGGCCGGACCGCTGGCAACAAAAGG ATAAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGC AGCACCTGTCTCACAGTTCCCGAAGGCACCCTCGTATCTCTACAAGGTTCTGTGGATGTCAAGACCAGGT AAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCAT TTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCC TCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGC TCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAG ATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCA GATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGC CCAGTAATTTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCT TCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTA CAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCC ACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGC TAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCA AGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTAT CCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCAGCGAAAAAGCAAGCTGT TTCCTGTTACCGTTCGACTTGCA

bottom of page